Skip to main content

Table 1 The primers used in this experiment

From: Glycyrrhizin improves the pathogenesis of psoriasis partially through IL-17A and the SIRT1-STAT3 axis

Gene Forward Primer (5′ - > 3′) Reverse Primer
Human STAT3 CAGCAGCTTGACACACGGTA AAACACCAAAGTGGCATGTGA
Mouse STAT3 CACCTTGGATTGAGAGTCAAGAC AGGAATCGGCTATATTGCTGGT
Human SIRT1 TAGCCTTGTCAGATAAGGAAGGA ACAGCTTCACAGTCAACTTTGT
Mouse SIRT1 TGATTGGCACCGATCCTCG CCACAGCGTCATATCATCCAG
Human GAPDH ACCTTAACCGCCTTATTAGCCA CACCACGGTACAACAGGCA
Mouse GAPDH CCTAAACAGGTTGATAGGCCAAA CTCGCCTTCCACAGAATCCA